bio scale mini macro prep high q bio rad (Bio-Rad)
Bio-Rad is a verified supplier 
Bio-Rad manufactures this product 
92
Structured Review
Bio-Rad
bio scale mini macro prep high q bio rad
Bio Scale Mini Macro Prep High Q Bio Rad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 92/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bio+scale+mini+macro+prep+high+q+bio+rad/Bio-Scale+Mini+Macro-Prep+High+Q+Cartridges/pm38198950-206-199-205
Average 92 stars, based on 10 article reviews
Bio Scale Mini Macro Prep High Q Bio Rad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 92/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bio+scale+mini+macro+prep+high+q+bio+rad/Bio-Scale+Mini+Macro-Prep+High+Q+Cartridges/pm38198950-206-199-205
Average 92 stars, based on 10 article reviews
bio scale mini macro prep high q bio rad - by Bioz Stars,
2026-10
92/100 stars
Images
Related Articles
Recombinant:Article Title: Engineering the ADDobody protein scaffold for generation of high-avidity ADDomer super-binders. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli BL21(DE3) Thermo Fisher #C600003 MultiBac baculovirus Fitzgerald et al.41 N/A Hi5 insect cells Invitrogen #B85502 Chemicals, peptides, and recombinant proteins Tryptone Sigma #1079-40-2 Yeast extract Sigma #8013-01-2 Isopropyl b-d-1-thiogalactopyranoside (IPTG) Sigma #367-93-1 COmplete EDTA-free protease inhibitor Roche #11836153001 Benzonase Millipore #E1014 KH2PO4 Sigma #7778-77-0 TRIS hydrochloride Sigma #1185-53-1 HEPES Sigma #7365-45-9 Sodium citrate Sigma #6132-04-3 NaCl Sigma #7647-14-5 KCl Sigma #7447-40-7 Na-Acetate Sigma #127-09-3 Magnesium Acetate Sigma #16674-78-5 Zinc-Acetate Sigma #5970-45-6 Imidazole Sigma #288-32-4 Ethylene-dinitrilo-tetraacetic acid (EDTA) Sigma #60-00-4 Tween 20 Roche #11332465001 NP-40 Detergent Sigma #9016-45-9 Glycine Sigma #56-40-6 PEG6000 Sigma #81260 PEG3350 Sigma #88276 2-Methyl-2,4-pentanediol (MPD) Sigma #107-41-5 Ethanolamine Sigma #141-43-5 Tobacco Etch Virus (TEV) protease Home-purified clone N/A BirA Biotin Ligase Home-purified clone N/A Streptavidin Sigma #9013-20-1 TranscriptAid RNA Kit Thermo Fisher #K0441 RNAeasy Kit Qiagen #74004 SuperScript IV cDNA Kit Thermo Fisher #11750150 Q5 DNA polymerase New England Biolabs #M0491 QIAquick Gel Extraction Kit Qiagen #28704 PstI HF Restriction Enzyme New England Biolabs #R3140 Streptavidin Magnetic Beads Thermo Fisher/Pierce #88816 SuperBlock Thermo Fisher #37515 EDC/NHS Amine-Coupling Kit Cytiva #BR100050 SYPRO Orange Thermo Fisher #S6650 Deposited data ADDobody Xtal This study PDB ID: 8COI ADDobody Xtal (with zinc) This study PDB ID: 8QB3 Chimera ADDomer AH0 map This study EMDB ID: EMD-18323 (Continued on next page) Structure 32, 1–10.e1–e6, March 7, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chimera ADDomer AH0 atomic model This study PDB ID: 8QBX Oligonucleotides T7B_F_v3 [50 ATACGAAATTAATACGACTCAC TATAGGGAGACCACAACGGTTTCCCTCTA GAAATAATTTTG 3’] This study N/A A1.MS-SDA-ADDobody-F [50 AGACCACAACGGT TTCCCTCTAGAAATAATTTTGTTTAACTTTAAG AAGGAGATATATATGGGATCCGGAATTCAACC 3’] This study N/A tonBtot_R [50CCGCACACCAGTAAGGTGTGC GGTCAGGATATTCACCACAATCCC 3’] This study N/A A14-tonB-ADDobody-R [50 CCGCACACCAGTA AGGTGTGCGGTCAGGATATTCAC 3’] This study N/A Recombinant DNA pPROEX-HTB Invitrogen #10711018 pPROEX-HTB-ADDobody-Xtal This study N/A pPROEX-HTB-ADDobody-AH0 This study N/A pPROEX-HTB-ADDobody-VL This study N/A pPROEX-HTB-ADDobody-RGD This study N/A pPROEX-HTB-ADDobody-VLRGD This study N/A pPROEX-HTB-ADDobody-57 This study N/A pHEN6 Conrath et al.42 N/A pHEN6-ADAH11_avi This study N/A pHEN6-ADAH11 This study N/A pACEBac1 Geneva Biotech SARL, Switzerland41 N/A pACEBac1-Chimera ADDomer This study N/A Software and algorithms Biacore T200 Evaluation Software Cytiva https://www.cytivalifesciences.com/ XDS Kabsch43 https://xds.mr.mpg.de/html_doc/ XDS.html PHASER McCoy et al.44 https://www/ccp4.ac.uk PHENIX version 1.17.1–3660 Liebschner et al.45 https://www/ccp4.ac.uk Coot Emsley & Cowtan46 https://www/ccp4.ac.uk MolProbity Williams et al.47 https://www/ccp4.ac.uk PYMOL Schreodinger, LLC http://www.pymol.org RELION 3.1 Fernandez-Leiro & Scheres48 https://www.ccpem.ac.uk/ MotionCorr2 Zheng et al.49 https://emcore.ucsf.edu/ucsf-software Ctffind4.1 Rohou & Grigorieff50 https://grigoriefflab.umassmed.edu/ ctffind4 I-TASSER Yang & Zhang51 https://zhanggroup.org/I-TASSER/ download/ UCSF Chimera software Pettersen et al.52 https://www.cgl.ucsf.edu/chimera/ download.html EMRinger Barad et al.53 https://github.com/fraser-lab/ EMRinger Other Mono Q 5/50 GL column Cytiva #17516601 Superdex 200 10/300 GL column Cytiva #17517501 Superdex 200 26/100 column Cytiva #90100273 Software:Article Title: Engineering the ADDobody protein scaffold for generation of high-avidity ADDomer super-binders. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli BL21(DE3) Thermo Fisher #C600003 MultiBac baculovirus Fitzgerald et al.41 N/A Hi5 insect cells Invitrogen #B85502 Chemicals, peptides, and recombinant proteins Tryptone Sigma #1079-40-2 Yeast extract Sigma #8013-01-2 Isopropyl b-d-1-thiogalactopyranoside (IPTG) Sigma #367-93-1 COmplete EDTA-free protease inhibitor Roche #11836153001 Benzonase Millipore #E1014 KH2PO4 Sigma #7778-77-0 TRIS hydrochloride Sigma #1185-53-1 HEPES Sigma #7365-45-9 Sodium citrate Sigma #6132-04-3 NaCl Sigma #7647-14-5 KCl Sigma #7447-40-7 Na-Acetate Sigma #127-09-3 Magnesium Acetate Sigma #16674-78-5 Zinc-Acetate Sigma #5970-45-6 Imidazole Sigma #288-32-4 Ethylene-dinitrilo-tetraacetic acid (EDTA) Sigma #60-00-4 Tween 20 Roche #11332465001 NP-40 Detergent Sigma #9016-45-9 Glycine Sigma #56-40-6 PEG6000 Sigma #81260 PEG3350 Sigma #88276 2-Methyl-2,4-pentanediol (MPD) Sigma #107-41-5 Ethanolamine Sigma #141-43-5 Tobacco Etch Virus (TEV) protease Home-purified clone N/A BirA Biotin Ligase Home-purified clone N/A Streptavidin Sigma #9013-20-1 TranscriptAid RNA Kit Thermo Fisher #K0441 RNAeasy Kit Qiagen #74004 SuperScript IV cDNA Kit Thermo Fisher #11750150 Q5 DNA polymerase New England Biolabs #M0491 QIAquick Gel Extraction Kit Qiagen #28704 PstI HF Restriction Enzyme New England Biolabs #R3140 Streptavidin Magnetic Beads Thermo Fisher/Pierce #88816 SuperBlock Thermo Fisher #37515 EDC/NHS Amine-Coupling Kit Cytiva #BR100050 SYPRO Orange Thermo Fisher #S6650 Deposited data ADDobody Xtal This study PDB ID: 8COI ADDobody Xtal (with zinc) This study PDB ID: 8QB3 Chimera ADDomer AH0 map This study EMDB ID: EMD-18323 (Continued on next page) Structure 32, 1–10.e1–e6, March 7, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chimera ADDomer AH0 atomic model This study PDB ID: 8QBX Oligonucleotides T7B_F_v3 [50 ATACGAAATTAATACGACTCAC TATAGGGAGACCACAACGGTTTCCCTCTA GAAATAATTTTG 3’] This study N/A A1.MS-SDA-ADDobody-F [50 AGACCACAACGGT TTCCCTCTAGAAATAATTTTGTTTAACTTTAAG AAGGAGATATATATGGGATCCGGAATTCAACC 3’] This study N/A tonBtot_R [50CCGCACACCAGTAAGGTGTGC GGTCAGGATATTCACCACAATCCC 3’] This study N/A A14-tonB-ADDobody-R [50 CCGCACACCAGTA AGGTGTGCGGTCAGGATATTCAC 3’] This study N/A Recombinant DNA pPROEX-HTB Invitrogen #10711018 pPROEX-HTB-ADDobody-Xtal This study N/A pPROEX-HTB-ADDobody-AH0 This study N/A pPROEX-HTB-ADDobody-VL This study N/A pPROEX-HTB-ADDobody-RGD This study N/A pPROEX-HTB-ADDobody-VLRGD This study N/A pPROEX-HTB-ADDobody-57 This study N/A pHEN6 Conrath et al.42 N/A pHEN6-ADAH11_avi This study N/A pHEN6-ADAH11 This study N/A pACEBac1 Geneva Biotech SARL, Switzerland41 N/A pACEBac1-Chimera ADDomer This study N/A Software and algorithms Biacore T200 Evaluation Software Cytiva https://www.cytivalifesciences.com/ XDS Kabsch43 https://xds.mr.mpg.de/html_doc/ XDS.html PHASER McCoy et al.44 https://www/ccp4.ac.uk PHENIX version 1.17.1–3660 Liebschner et al.45 https://www/ccp4.ac.uk Coot Emsley & Cowtan46 https://www/ccp4.ac.uk MolProbity Williams et al.47 https://www/ccp4.ac.uk PYMOL Schreodinger, LLC http://www.pymol.org RELION 3.1 Fernandez-Leiro & Scheres48 https://www.ccpem.ac.uk/ MotionCorr2 Zheng et al.49 https://emcore.ucsf.edu/ucsf-software Ctffind4.1 Rohou & Grigorieff50 https://grigoriefflab.umassmed.edu/ ctffind4 I-TASSER Yang & Zhang51 https://zhanggroup.org/I-TASSER/ download/ UCSF Chimera software Pettersen et al.52 https://www.cgl.ucsf.edu/chimera/ download.html EMRinger Barad et al.53 https://github.com/fraser-lab/ EMRinger Other Mono Q 5/50 GL column Cytiva #17516601 Superdex 200 10/300 GL column Cytiva #17517501 Superdex 200 26/100 column Cytiva #90100273 |